View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_low_70 (Length: 221)
Name: NF13295_low_70
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_low_70 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 2095565 - 2095474
Alignment:
| Q |
22 |
aagaacaaagaaaggttggtggaagagtggctagaagaagtttaaatcctgtcttgaaagaagttaaaaagcaaggtgtccggctacgactt |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| | |||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
2095565 |
aagaacaaagaagggttggtggaagagtggctagaagaagttcatgtcctgtcttggaagaggttaaaaagcaaggtgtccggcttcgactt |
2095474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University