View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13295_low_74 (Length: 204)
Name: NF13295_low_74
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13295_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 17 - 184
Target Start/End: Complemental strand, 5053318 - 5053151
Alignment:
| Q |
17 |
cacagagaaagagatgtgttctgagagtattagcttcaggacctctaaagggttaaaacgaatctgatattccttttgttcttgtttggaatgttatgag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053318 |
cacagagaaagagatgtgttctgagagtattagcttcaggacctctaaagggttaaaacgaatctgatattccttttgttcttgtttggaatgttatgag |
5053219 |
T |
 |
| Q |
117 |
aaagaagggaaaaaagtattgatcatatttaagaattgtctataatttggattcttttaagtgttgtt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5053218 |
aaagaagggaaaaaagtattgatcatatttaagaattgtctataatttggattcttttgagtgttgtt |
5053151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University