View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13296_low_23 (Length: 237)
Name: NF13296_low_23
Description: NF13296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13296_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1756085 - 1756301
Alignment:
| Q |
1 |
cctaaataattgatttaagtttgaacttatcctcaatttagtcgtgctcaattttacannnnnnngattataaagcccnnnnnnntgcttgaagttactt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||| ||||||||| |
|
|
| T |
1756085 |
cctaaataatttatttaagtttgaacttatcctcaatttagtcgtgctcaattttacatttttttgattataaatcccaaaaaaatgcttcaagttactt |
1756184 |
T |
 |
| Q |
101 |
tctggaaaggtcatttacttttaacccatcattgtcttcaacttcaaaattacacctaggaatctaggatgttgtctcatagt----aataggaacacac |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
1756185 |
tctggaaaggtcatttacttttaacccatcattgtcttcaacttcaaaattacac--------ctaggatgttgtctcatagtagccaataggaacacac |
1756276 |
T |
 |
| Q |
197 |
aacctacacttaatttagattaaac |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1756277 |
aacctacacttaatttagattaaac |
1756301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 51
Target Start/End: Original strand, 29036771 - 29036819
Alignment:
| Q |
3 |
taaataattgatttaagtttgaacttatcctcaatttagtcgtgctcaa |
51 |
Q |
| |
|
|||| |||||| || || |||||||||||||||||||| |||||||||| |
|
|
| T |
29036771 |
taaacaattgaattcagcttgaacttatcctcaatttaatcgtgctcaa |
29036819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University