View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13296_low_8 (Length: 391)
Name: NF13296_low_8
Description: NF13296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13296_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 1 - 373
Target Start/End: Complemental strand, 6322267 - 6321895
Alignment:
| Q |
1 |
atgacacctctctagagaagttgtaactgactgaacaggctcaacttgaggatatggaatcatatagctacgatgttgagtctgtgaatattggagtgaa |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6322267 |
atgactcctctctagagaagttggaactgactgaacaggctcaacttgaggatatggaatcatatagctacgatgttgagtctgtgaatattggagtgaa |
6322168 |
T |
 |
| Q |
101 |
gggggctcagtcttcatgaacccatatatgggctcaaaagaagaggtttttggtgccatgtgaataccgaccatagggttatcatattcattaaactgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6322167 |
gggggctcagtcttcatgaacccatatatgggctcaaaagaagaggtttttggtgccatgtgaataccgaccatagggttatcatattcattaaactgat |
6322068 |
T |
 |
| Q |
201 |
tgtagctatgtggttcattaatatcctcccatggaggagacgaaggagacggcataggatattttctgagctgatcaaatgctgctggggcagcagcatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6322067 |
tgtagctatgtggttcattaatatcctcccatggaggagacgaaggagatggcataggatattttctgagctgatcaaatgctgctggggcagcagcatt |
6321968 |
T |
 |
| Q |
301 |
attgctataactgtacaaattcatatcggacttccaagggcgcttagagggacgcaataacaagccagctaga |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6321967 |
attgctataactgtacaaattcatatcggacttccaagggcgcttagagggacgcaataacaagccagctaga |
6321895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University