View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13298_high_10 (Length: 236)
Name: NF13298_high_10
Description: NF13298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13298_high_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 36823227 - 36823012
Alignment:
| Q |
18 |
taagcctcgtcaaatgctaacatttggggacatttgtttcaatttatctaaaataattcttggcggggattaaggtagttataagaataaaaaataaata |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36823227 |
taagcctcgtcaaatgccaacatttggggacatttgtttcaatttatctaaaatcattcttggcggggattaaggtagttataagaataaaaaataaata |
36823128 |
T |
 |
| Q |
118 |
caaaagttcattcacgcttcatgggcaagtttctgaagccttcattgatgcaaacaatgaaaatggggaagttattttcttcctaggaatgctttacagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36823127 |
caaaagttcattcacgcttcatgggcaagtttccgaa---ttccttgatgcaaacaatgaaaatggggaagttattttcttcctaggaatgctttacagt |
36823031 |
T |
 |
| Q |
218 |
tgggaataaaatttgcaac |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36823030 |
tgggaataaaatttgcaac |
36823012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University