View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13298_low_14 (Length: 205)
Name: NF13298_low_14
Description: NF13298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13298_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 26920369 - 26920532
Alignment:
| Q |
1 |
ttctttgccatggtgaaatcttcctttttgggtcaccaccagagctttcttcagctggaaaatttggttcatcttcatcactcatctgagaactttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920369 |
ttctttgccatggtgaaatcttcctttttgggtcaccaccagagctttcttcagctggaaaatttggttcatcttcatcactcatctgagaactttgttg |
26920468 |
T |
 |
| Q |
101 |
ttgctgtttgttcttggatgaagaaaatggaggaaacccatgtttcattgaatgatgatgatgt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920469 |
ttgctgtttgttcttggatgaagaaaatggaggaaacccatgtttcattgaatgatgatgatgt |
26920532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University