View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13298_low_15 (Length: 205)
Name: NF13298_low_15
Description: NF13298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13298_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 26920393 - 26920239
Alignment:
| Q |
1 |
aggaagatttcaccatggcaaagaatgaaatggactgatacaatggtaaggctattgataatggctgtttattacattggtgatgaagctggttctgaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920393 |
aggaagatttcaccatggcaaagaatgaaatggactgatacaatggtaaggctattgataatggctgtttattacattggtgatgaagctggttctgaag |
26920294 |
T |
|
| Q |
101 |
ggactgatccaaataagaaaaagtctagtggtttgttacagaagaagggaaagtg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920293 |
ggactgatccaaataagaaaaagtctagtggtttgttacagaagaagggaaagtg |
26920239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 10 - 93
Target Start/End: Original strand, 41824900 - 41824983
Alignment:
| Q |
10 |
tcaccatggcaaagaatgaaatggactgatacaatggtaaggctattgataatggctgtttattacattggtgatgaagctggt |
93 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| || || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41824900 |
tcaccatggcatagaatgaaatggacagatacaatggtaagactcttaataatggctgtttattacattggtgatgaagctggt |
41824983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University