View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13298_low_16 (Length: 203)
Name: NF13298_low_16
Description: NF13298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13298_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 26920509 - 26920601
Alignment:
| Q |
1 |
tgtttcattgaatgatgatgatgttgatttgtgtcagtgtcatgatgttggggagcataggaaacaacttgggaatggtgcaattgatgagga |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920509 |
tgtttcattgaatgatgatgatgttgatttgtgtcagtgtcatgatgttggggagcataggaaacaacttgggaatggtgcaattgatgagga |
26920601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 145 - 189
Target Start/End: Original strand, 26920659 - 26920703
Alignment:
| Q |
145 |
aaagggatattatcaactactcctaacaaaccagaaggagtgatg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920659 |
aaagggatattatcaactactcctaacaaaccagaaggagtgatg |
26920703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University