View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13299_high_13 (Length: 293)
Name: NF13299_high_13
Description: NF13299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13299_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 17 - 286
Target Start/End: Complemental strand, 11612134 - 11611865
Alignment:
| Q |
17 |
attgcttgaagataggatcttggttaacgctaccagggttcttaatgtcttgccatcttctaatctcgacgtaatggaacaaaatgaactcgatcacaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612134 |
attgcttgaagataggatcttggttaacgctaccagggttcttaatgtcttgccatcttctaatctcgacgtaatggaacaaaatgaactcgatcacaaa |
11612035 |
T |
 |
| Q |
117 |
gagtgttgaagatgaagcaaagtattcttctttccctgcatcataccattttggaacgttgatgattccaatgttggtgaagacttcagggagtaacatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612034 |
gagtgttgaagatgaagcaaagtattcttctttccctgcatcataccattttggaacgttgatgattccaatgttggtgaagacttcagggagtaacatc |
11611935 |
T |
 |
| Q |
217 |
cctgcaacacctaacatagcccaacgtccattcacaagctcggcttgaacaaaccatttcaagttctctg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11611934 |
cctgcaacacctaacatagcccaacgtccattcacaagctcggcttgaacaaaccatttcaagttctctg |
11611865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University