View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13299_low_15 (Length: 269)
Name: NF13299_low_15
Description: NF13299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13299_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 9 - 190
Target Start/End: Original strand, 25307216 - 25307398
Alignment:
| Q |
9 |
tagattatacttattcattggcggtgacacatgaaaataatgtgagaaccnnnnnnnctttgactcaaataatgagtggactttgttgctctgaggctta |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25307216 |
tagattctacttattcattggcggtgacacatgaaaataatgtgagaacctttttttctttgactcaaataatgagtggactttgttgctccgaggctta |
25307315 |
T |
 |
| Q |
109 |
cgaaatcaaactcatagtatgaatctttatatnnnnnnnta-actctaaagcacattgttttacgaaaatgaatctttaagca |
190 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25307316 |
cgaaatcaaactcatattatgaatctttatataaaaaaaaagattctaaagcacattgttttacgaaaatgaatctttaagca |
25307398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 186 - 235
Target Start/End: Original strand, 25307364 - 25307413
Alignment:
| Q |
186 |
aagcacattgttttacaaaaatgaatctttaagcatgttaccaattctaa |
235 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25307364 |
aagcacattgttttacgaaaatgaatctttaagcatgttaccaattctaa |
25307413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University