View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1329_high_4 (Length: 338)
Name: NF1329_high_4
Description: NF1329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1329_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 522018 - 522354
Alignment:
| Q |
1 |
ttacagcaaatgtatatgagtttcataagtatgatgtggcattggggtgaccaattgatagaagtgtatgaaactcagagtgagttctttaaaatatgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
522018 |
ttacagcaaatgtatatgagtttcataagtatgatgtggtattgtggtgaccaattgatagaagtgtatgaaactcagagtgagttctttaaaatatgac |
522117 |
T |
|
| Q |
101 |
cattggagatgctctaagtagcgt-----ccttacttgagtatttactagcaaagtatttcacattacctttcatatgttaagtaagcagtggtttagtt |
195 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
522118 |
cattggagatgctctaagtagcgtagcgtctttacttgagtatttactagcaaagtatttcacattacctttcatatgttaagtaagcagtggtttagtt |
522217 |
T |
|
| Q |
196 |
tttctgtggcatgtgtttgtagatctatagttggtgcagatgggaaaatcaggctaccatggctcttattgatggaaatttgcaaggtaaacgacgtaaa |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || | |
|
|
| T |
522218 |
tttctgtggcatgtgtttgtagatctatagttggtgcagatgggaaaatcaggctaccatggctcttattgatggaaatttgcaaggtaaacatcataga |
522317 |
T |
|
| Q |
296 |
aatcaaatg-cgcttcgttgatgacaccaacctttgt |
331 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
522318 |
aatcaaatgttgcttcattgatgacaccaacctttgt |
522354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 4309064 - 4309100
Alignment:
| Q |
8 |
aaatgtatatgagtttcataagtatgatgtggcattg |
44 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4309064 |
aaatggatatgagtttcataagtatgatgtggcattg |
4309100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University