View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1329_high_5 (Length: 325)
Name: NF1329_high_5
Description: NF1329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1329_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 14733195 - 14733431
Alignment:
| Q |
1 |
aagaaatatacttaatgatgagaattgacgtgagaggtaattaaggtcttcttggacctgcagatcccacagtattgacaataatagcgtctaatgtctc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14733195 |
aagaaatatacttgatgatgagaattgatgtgagaggtaattaaggtcttcttggacctgcagatcccacagtattgacaataatagcgtctaatgtctc |
14733294 |
T |
|
| Q |
101 |
tgaaaataggtctttcgttactttcaaatgaatcatccatctctgtatttggcatttcgtgattgcttccgcggtttgcttcgaatttttcagacggcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
14733295 |
tgaaaataggtctttcgttactttcaaatgaatcatccatctctgtatttggcatttcgtgattgcttctgcggtttgcttcgaatttctcagacggca- |
14733393 |
T |
|
| Q |
201 |
cctgagtttgttacactgcaccgttaacaaactccactcaaatcca |
246 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14733394 |
--------tgttacactgcaccgttaacaaactcaactcaaatcca |
14733431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 296
Target Start/End: Original strand, 14733441 - 14733477
Alignment:
| Q |
260 |
ttcctttttaaacatggtcttgctaatgagtacttaa |
296 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
14733441 |
ttcctttttaaacatggtcttgttaacgagtacttaa |
14733477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University