View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1329_low_10 (Length: 338)

Name: NF1329_low_10
Description: NF1329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1329_low_10
NF1329_low_10
[»] chr2 (1 HSPs)
chr2 (1-331)||(522018-522354)
[»] chr1 (1 HSPs)
chr1 (8-44)||(4309064-4309100)


Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 522018 - 522354
Alignment:
1 ttacagcaaatgtatatgagtttcataagtatgatgtggcattggggtgaccaattgatagaagtgtatgaaactcagagtgagttctttaaaatatgac 100  Q
    ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
522018 ttacagcaaatgtatatgagtttcataagtatgatgtggtattgtggtgaccaattgatagaagtgtatgaaactcagagtgagttctttaaaatatgac 522117  T
101 cattggagatgctctaagtagcgt-----ccttacttgagtatttactagcaaagtatttcacattacctttcatatgttaagtaagcagtggtttagtt 195  Q
    ||||||||||||||||||||||||     | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
522118 cattggagatgctctaagtagcgtagcgtctttacttgagtatttactagcaaagtatttcacattacctttcatatgttaagtaagcagtggtttagtt 522217  T
196 tttctgtggcatgtgtttgtagatctatagttggtgcagatgggaaaatcaggctaccatggctcttattgatggaaatttgcaaggtaaacgacgtaaa 295  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  | || |    
522218 tttctgtggcatgtgtttgtagatctatagttggtgcagatgggaaaatcaggctaccatggctcttattgatggaaatttgcaaggtaaacatcataga 522317  T
296 aatcaaatg-cgcttcgttgatgacaccaacctttgt 331  Q
    |||||||||  ||||| ||||||||||||||||||||    
522318 aatcaaatgttgcttcattgatgacaccaacctttgt 522354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 4309064 - 4309100
Alignment:
8 aaatgtatatgagtttcataagtatgatgtggcattg 44  Q
    ||||| |||||||||||||||||||||||||||||||    
4309064 aaatggatatgagtttcataagtatgatgtggcattg 4309100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University