View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1329_low_15 (Length: 260)
Name: NF1329_low_15
Description: NF1329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1329_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 86 - 166
Target Start/End: Complemental strand, 35364701 - 35364621
Alignment:
| Q |
86 |
agggtttcgtaattattttctaacttacaacgaattattggtgaacaggatttgttacatcaaagaaagcttgttgtgagt |
166 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364701 |
agggtttcataattattttctaacttacaacgaattattggtgaacaggatttgttacatcaaagaaagcttgttgtgagt |
35364621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 163
Target Start/End: Complemental strand, 35376422 - 35376388
Alignment:
| Q |
129 |
aacaggatttgttacatcaaagaaagcttgttgtg |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35376422 |
aacaggatttgttacatcaaagatagcttgttgtg |
35376388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University