View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1329_low_17 (Length: 251)
Name: NF1329_low_17
Description: NF1329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1329_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 39053951 - 39053709
Alignment:
| Q |
1 |
aaatttaaaatctttgatcatctccttttgcataactcgatttaatttaatccttgaaattttctaactgagaattttaagattgagtgatattttttaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39053951 |
aaatttaaaatctttgatcatttccttttgcataactcgatttaatttaatccttgaaattttctaactgagaattttcagattgagtgatattttttaa |
39053852 |
T |
 |
| Q |
101 |
ttctgttagttttagaaaagnnnnnnncaaacnnnnnnnngttacaagaggaaaaaagaacaatttgagattaaattgataattcagtaaaaaagcaaac |
200 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39053851 |
ttctgttagttttagaaaag-aaaaaacaaac--ttttttgttacaaga-gaaaaaagaacaatttgagattaaattgatgattcagtaaaaaagcaaac |
39053756 |
T |
 |
| Q |
201 |
aatgatggcgaacatgaatgaaatggaatataccgttcttctctctc |
247 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
39053755 |
aatgatggcgaacatgaaagaaatggaatataccgttcttttctctc |
39053709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University