View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1329_low_9 (Length: 345)
Name: NF1329_low_9
Description: NF1329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1329_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 29 - 327
Target Start/End: Original strand, 36228111 - 36228409
Alignment:
| Q |
29 |
accaaagaagcccttaacttatttgtttctcttcttcattcgtctttacaacccgacgaatccacattgtcgtgtgttttcaatatttgtgctggttcct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36228111 |
accaaagaagcccttaacttatttgtttctcttcttcattcgtctttacaacccgacgaatccacattgtcgtgtgttttcaatatttgtgctggttcct |
36228210 |
T |
|
| Q |
129 |
tggatgggaaattgggtaggcaagttcattgtcaatgtgttaaatttggacttgtggatcatgttagtgttggaacttcacttgttgatatgtatatgaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36228211 |
tggatgggaaattgggtaggcaagttcattgtcaatgtgttaaatttggacttgtggatcatgttagtgttggaacttcacttgttgatatgtatatgaa |
36228310 |
T |
|
| Q |
229 |
aactgagaatgttaatgatggaagaagagtttttgatgaaatgggtgagaggaatgttgtgtcttggacttcgttgcttgcgggttattcatggaatgg |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36228311 |
aactgagaatgttaatgatggaagaagagtttttgatgaaatgggtgagaggaatgttgtgtcttggacttcgttgcttgcgggttattcatggaatgg |
36228409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University