View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13300_high_9 (Length: 202)

Name: NF13300_high_9
Description: NF13300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13300_high_9
NF13300_high_9
[»] chr4 (1 HSPs)
chr4 (11-186)||(47616579-47616755)


Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 186
Target Start/End: Complemental strand, 47616755 - 47616579
Alignment:
11 ggagcagagatggataattcagatagcagacacatagtttcactc-ggaaaattaacagatgttagattcatggcatgtttccgtttcaagctatggtgg 109  Q
    |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47616755 ggagcagaaatggataattcagatagcagacacatagtttcactctggaaaattaacagatgttagattcatggcatgtttccgtttcaagctatggtgg 47616656  T
110 atggcacaaagaatgggagataaaggaagccaagttccattagaaactcaattcttattggttgaaaccaaagatgg 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47616655 atggcacaaagaatgggagataaaggaagccaagttccattagaaactcaattcttattggttgaaaccaaagatgg 47616579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University