View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13300_high_9 (Length: 202)
Name: NF13300_high_9
Description: NF13300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13300_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 186
Target Start/End: Complemental strand, 47616755 - 47616579
Alignment:
| Q |
11 |
ggagcagagatggataattcagatagcagacacatagtttcactc-ggaaaattaacagatgttagattcatggcatgtttccgtttcaagctatggtgg |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47616755 |
ggagcagaaatggataattcagatagcagacacatagtttcactctggaaaattaacagatgttagattcatggcatgtttccgtttcaagctatggtgg |
47616656 |
T |
 |
| Q |
110 |
atggcacaaagaatgggagataaaggaagccaagttccattagaaactcaattcttattggttgaaaccaaagatgg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47616655 |
atggcacaaagaatgggagataaaggaagccaagttccattagaaactcaattcttattggttgaaaccaaagatgg |
47616579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University