View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13300_low_14 (Length: 250)
Name: NF13300_low_14
Description: NF13300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13300_low_14 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 5 - 250
Target Start/End: Complemental strand, 3182894 - 3182649
Alignment:
| Q |
5 |
tctcgaagaatatgggagcttttcctgagctgcacgctggcactctggtttgcttgaaatccagacataccctacatctactacagatgcagcatatgcc |
104 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3182894 |
tctcgaagcaaatgggagcttttcctgagctgcacgatggcactctgttttgcttgaaatccagacataccctacatctactacagatgcagcatatgcc |
3182795 |
T |
|
| Q |
105 |
catcttgcaactctacaagacaaaaaataatttcaatgcatatctaccaagtaataggggagtcatactaaaagtaacgagcataattagttatagcaca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||| || |
|
|
| T |
3182794 |
catcttgcaactctacaagacaaaaaataatttcaatgcatatctaccaagtaataggggagtcataataaaagtaacaagcataattagttctagtgca |
3182695 |
T |
|
| Q |
205 |
ttgtagggattatctgttgattgcttaaatgtaatgtcagaataca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3182694 |
ttgtagggattatctgttgattgcttaaatgtaatgtcagaataca |
3182649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 191 - 250
Target Start/End: Complemental strand, 3176664 - 3176605
Alignment:
| Q |
191 |
ttagttatagcacattgtagggattatctgttgattgcttaaatgtaatgtcagaataca |
250 |
Q |
| |
|
|||||| ||||||||| | ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3176664 |
ttagttctagcacattatggggattagttgttgattgcttaaatgtaatgtcagaataca |
3176605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University