View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13301_low_12 (Length: 340)
Name: NF13301_low_12
Description: NF13301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13301_low_12 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 19 - 340
Target Start/End: Complemental strand, 7088924 - 7088603
Alignment:
| Q |
19 |
ccttcatcttacctttcttcatggaatgaagatgatatcaatccatgttcatggcaatatgtgaaatgcaatccacaaactcaaagagtctcagaacttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7088924 |
ccttcatcttacctttcttcatggaatgaagatgatatcaatccatgttcatggcaatatgtgaaatgcaatccacaaactcaaagagtctcagaacttt |
7088825 |
T |
|
| Q |
119 |
ccttagatggtttaggcttatcaggtaaattaggaagaagtcttgaaaaattgcaacatttagtaacattatcactttcacacaacaatttcagtggaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7088824 |
ccttagatggtttaggcttatcaggtaaattaggaagaagtcttgaaaaattgcaacatttagtaacattatcactttcacacaacaatttcagtggaac |
7088725 |
T |
|
| Q |
219 |
tattagtccttcacttacactttccaacactcttcaaaaactaaaccttagtcacaactcattttctggtccattacctctttcttttgtcaacattagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7088724 |
tattagtccttcacttacactttccaacactcttcaaaaactaaaccttagtcacaactcattttctggtccattacctctttcttttgtcaacatgagt |
7088625 |
T |
|
| Q |
319 |
tcaataaggttcatcgatctct |
340 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
7088624 |
tcaataaggttcattgatctct |
7088603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University