View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13301_low_8 (Length: 402)
Name: NF13301_low_8
Description: NF13301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13301_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 7e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 255 - 331
Target Start/End: Complemental strand, 28143778 - 28143702
Alignment:
| Q |
255 |
agaagtgttggtataccaggaaatgatggtgagttatttggttaagattgtatgaagagtttcccattccgaatcca |
331 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28143778 |
agaagtgttggtataccaggaaaggatggtgagtgatttggttaagattgtatgaagagtttcccattccgaatcca |
28143702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 111 - 153
Target Start/End: Complemental strand, 28143921 - 28143879
Alignment:
| Q |
111 |
cttacaaaggacaaagcaaagtaattggaggcctgcatgtaac |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28143921 |
cttacaaaggacaaagcaaagtaattggaggcctgcatgtaac |
28143879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University