View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13302_high_9 (Length: 312)
Name: NF13302_high_9
Description: NF13302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13302_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 22 - 294
Target Start/End: Complemental strand, 46752030 - 46751758
Alignment:
| Q |
22 |
atgttttgcttttgcttttgctttcagtaggaattttataacgtttatgcgtcgttgaatgtgggttttagggaatgatttctgagacaataaggaagaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752030 |
atgttttgcttttgcttttgctttcagtaggaattttataacgtttatgcgtcgttgaatgtgggttttagggaatgatttctgagacaataaggaagaa |
46751931 |
T |
 |
| Q |
122 |
agaggggtccattgaattttccaaataaactcataaagataaggaatcgttacaaaaacgatagagaattgggccatatatggtaattctatatttaaag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751930 |
agaggggtccattgaattttccaaataaactcataaagataaggaatcgttacaaaaacgatagagaattgggccatatatggtaattctatatttaaag |
46751831 |
T |
 |
| Q |
222 |
agtagaacaagtggtcctacattttagaatgtgctaagtcttcgtatcattttcttccacctatagattatag |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46751830 |
agtagaacaagtggtcctacattttagaatgtgctaagtcttcgtatcattttcttccacctttagattatag |
46751758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University