View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13302_low_11 (Length: 308)
Name: NF13302_low_11
Description: NF13302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13302_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 247
Target Start/End: Original strand, 42007065 - 42007292
Alignment:
| Q |
20 |
acagcctttttagtttacactccgaaactgagtcactttacttgctgatgcaatatttgtcttccaaaccaaacaatcttttcagattttcatcttctct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42007065 |
acagcctttttagtttacactccgaaactgagtcactttacttgctgatgcaatatttgtcttccaaaccaaacaatcttttcagattttcatcttctct |
42007164 |
T |
|
| Q |
120 |
tttcttctcttcaagtaatatcgtgattcttcgccgtgattttattccacaatttaatgccattaattctctaatctcctcaaaattttcatcattcatc |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42007165 |
ttccttctcttcaagtaatatcgtgattcttcgccgtgattttattccacaatttaatgccattaattctctaatctcctcaaaattttcatcattcatc |
42007264 |
T |
|
| Q |
220 |
tttaccacttccaagcccttgaaggtcc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42007265 |
tttaccacttccaagcccttgaaggtcc |
42007292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 308
Target Start/End: Original strand, 42007325 - 42007353
Alignment:
| Q |
280 |
attgccaattcattcaaatgttgaaactt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42007325 |
attgccaattcattcaaatgttgaaactt |
42007353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 20 - 247
Target Start/End: Original strand, 1242414 - 1242641
Alignment:
| Q |
20 |
acagcctttttagtttacactccgaaactgagtcactttacttgctgatgcaatatttgtcttccaaaccaaacaatcttttcagattttcatcttctct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1242414 |
acagcctttttagtttacactccgaaactgagtcactttacttgctgatgcaatatttgtcttccaaaccaaacaatcttttcagattttcatcttctct |
1242513 |
T |
|
| Q |
120 |
tttcttctcttcaagtaatatcgtgattcttcgccgtgattttattccacaatttaatgccattaattctctaatctcctcaaaattttcatcattcatc |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1242514 |
ttccttctcttcaagtaatatcgtgattcttcgccgtgattttattccacaatttaatgccattaattctctaatctcctcaaaattttcatcattcatc |
1242613 |
T |
|
| Q |
220 |
tttaccacttccaagcccttgaaggtcc |
247 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
1242614 |
tttaccacttccaagcccttaaaggtcc |
1242641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 308
Target Start/End: Original strand, 1242674 - 1242702
Alignment:
| Q |
280 |
attgccaattcattcaaatgttgaaactt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1242674 |
attgccaattcattcaaatgttgaaactt |
1242702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University