View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13302_low_12 (Length: 294)
Name: NF13302_low_12
Description: NF13302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13302_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 275
Target Start/End: Original strand, 2337804 - 2338063
Alignment:
| Q |
16 |
attattctgtataggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttctctggtattagtac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2337804 |
attattctgtataggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttctctggtattagtac |
2337903 |
T |
|
| Q |
116 |
tgtctaacaatcaaattgacatagaatattattacttctaatcacttgatcattatgagatgtgccgtgtttgcttcgttcatttcaacattccaatgtc |
215 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2337904 |
tgtctaacaatcaaattgatatagtatattattacttctaatcacttgatcattatgagatgtgccgtgtttgcttcgtttatttcaacattccaatgtc |
2338003 |
T |
|
| Q |
216 |
atttgtcaatcgttgcccgctgttctttcttctttatggtggaaatctctatctcatact |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2338004 |
atttgtcaatcgttgcccgctgttctttcttctttatggtggaaatctctatctcatact |
2338063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 16 - 103
Target Start/End: Original strand, 2344686 - 2344773
Alignment:
| Q |
16 |
attattctgtataggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttctc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
2344686 |
attattctgtataggctggttggtgttggagaggcttcgtttataagtctagcagcaccttttattgatgacaatgccccagcttctc |
2344773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 95
Target Start/End: Original strand, 2324557 - 2324626
Alignment:
| Q |
26 |
ataggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgcccc |
95 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2324557 |
atagtctggttggtgttggtgaggcatcgtttataagtttagcagcccctttcattgatgacaacgcccc |
2324626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 275
Target Start/End: Original strand, 2344961 - 2345042
Alignment:
| Q |
194 |
ttcatttcaacattccaatgtcatttgtcaatcgttgcccgctgttctttcttctttatggtggaaatctctatctcatact |
275 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||| |||||||||| || ||| ||||||| |||| |||||||||| |
|
|
| T |
2344961 |
ttcatttcaacatatcaatgtcatttgtcaataactgctcgctgttcttatttatttctggtggacatcttaatctcatact |
2345042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 17 - 101
Target Start/End: Complemental strand, 36798572 - 36798488
Alignment:
| Q |
17 |
ttattctgtataggctggttggtgttggcgaggcttcgtttataagtttagcaccacctttcattgatgacaacgccccggcttc |
101 |
Q |
| |
|
||||||| | |||||| |||||||||||||||||||| ||||||||| | ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
36798572 |
ttattctctctaggctcgttggtgttggcgaggcttcatttataagtcttgcagcacctttcattgatgataacgccccagcttc |
36798488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University