View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13302_low_13 (Length: 287)
Name: NF13302_low_13
Description: NF13302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13302_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 6888821 - 6889090
Alignment:
| Q |
1 |
aacacatcaattacaatgtcatgatcactctgcagttatgcaaaataattgaatttttggccacactatcaaagaagaagaagtttacaaaagcctgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6888821 |
aacacatcaattacaatgtcatgatcaccctgcagttattcaaaataattgaacttttggccatactatcaaagaagaagaagtttacaaaagcctgtgt |
6888920 |
T |
 |
| Q |
101 |
atatagttgcagtaaatgctatgatgacaaacaactttgcagatatctgaggctgaaccctcatgnnnnnnncaaatcaaacatgatgaaaaacttcctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6888921 |
atatagttgcagtaaatgctatgatgacaaacaactttgcagatatctgaggctgaaccctcatgaaagaaacaaatcaaacatgatgaaaaacttcctt |
6889020 |
T |
 |
| Q |
201 |
gtaaggtaaagaaattaagaaagagtaaacacaaacaacaaactatgaacataagagaagagaaaaatct |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6889021 |
gtaaggtaaagaaattaagaaagagtaaacacaaacaacaaactatgaacataagagaagagaaaaatct |
6889090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University