View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13302_low_15 (Length: 277)
Name: NF13302_low_15
Description: NF13302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13302_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 55083603 - 55083361
Alignment:
| Q |
17 |
atgattatcattattttcagtgcaaaacttaagaacatttgttctaaactaatcaggatgcaagtccaattttaacccaaacaaagaaataaatgcaaga |
116 |
Q |
| |
|
|||||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55083603 |
atgattatgaatattttcagtgcaaaacttaataacatttgttctaaactaatcaggatgcaagtccaattttaacccaaacaaagaaataaatgcaaga |
55083504 |
T |
|
| Q |
117 |
agcacaagtttttgttaacaaaaatctctaaggctaagaaatttgttagtagcatatatctatatgcttgaaccttnnnnnnnnnnnngaagaagctata |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
55083503 |
agcacaagtttttgttaacaaaaatctctaaagctaagaaatttgttagtaccatatatctatatgcttgaaccttaaaaaacaaaaagaagaagctata |
55083404 |
T |
|
| Q |
217 |
tgcttgagttaacaaacgaaaactctagacaaaattgcatata |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55083403 |
tgcttgagttaacaaacgaaaactctagacaaaattgcatata |
55083361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University