View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13303_high_11 (Length: 217)
Name: NF13303_high_11
Description: NF13303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13303_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 55355298 - 55355496
Alignment:
| Q |
1 |
tggaagggaagagaagcttgcgtatgtgctgtttatgcaatgaaagaagagcttctctgaagagacctaaaacccttcaacagatttgcagagaatgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55355298 |
tggaagggaagagaagcttgcgtatgtgctgtttatgcaatgaaagaagagcttctctgaagagacctaaaacccttcaacagatttgcagagaatgctt |
55355397 |
T |
 |
| Q |
101 |
ctaccttgctttcgaagatgagattcatcaactcatcgtcgataactgcctcttcacccgcggcgaccgagtcgccatcggagcttccggcggtaaaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55355398 |
ctaccttgctttcgaagatgagattcatcaactcatcgtcgataaccgcctcttcacccgcggcgaccgaatcgccatcggagcttccggcggtaaaga |
55355496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 32398981 - 32399051
Alignment:
| Q |
1 |
tggaagggaagagaagcttgcgtatgtgctgtttatgcaatgaaagaagagcttctctgaagagacctaaa |
71 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32398981 |
tggaagggaagagaagcgtgcgtatgtgctgtttatgcaatgaaagaagagcttctctcaagagacctaaa |
32399051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University