View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13303_low_15 (Length: 294)
Name: NF13303_low_15
Description: NF13303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13303_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 42751806 - 42752083
Alignment:
| Q |
1 |
aaggaaaactcacagcagttgaatggttaattcagataaaaaagtggcactgttaccctttactcattctccactgtactagaaactattgcccccctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42751806 |
aaggaaaactcacagcagttgaatggttaattcagataaaa-agtggcactgttaccctttactcattctccactgtactagaaactattgcccccctta |
42751904 |
T |
|
| Q |
101 |
acttgaaacatgacagacttgagattcttccacagtctggtgggctggtagtctagccaaaacaaatcaagaattggggaataagaaggataaacgtgct |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42751905 |
acttgaaacatgacagacatgagattcttccacagtctggtgggctggtagtctagccaaaacaaatcaagaattggggaataagaaggataaacgtggt |
42752004 |
T |
|
| Q |
201 |
ttcaaggtttgacggcagaaattaacttttaccagcttaagttgtttgttttgacattgtcaatttggttcatattcat |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42752005 |
ttcaaggtttgacggcagaaattaacttttaccagcttaagttgtttgttttggcattgtcaatttggttcatattcat |
42752083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University