View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13303_low_16 (Length: 286)
Name: NF13303_low_16
Description: NF13303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13303_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 23220049 - 23220259
Alignment:
| Q |
20 |
gtaaaaacactaaacaacgtagtattattatta---gatcaatcnnnnnnncagaagagaaagcaacgttgtaatataaattgttatatattaattcacc |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23220049 |
gtaaaaacactaaacaacgtattattattattattagatcaatcaaaaaaacagaagagaaagcaacgttgtaatataaattgttatatatt----cacc |
23220144 |
T |
|
| Q |
117 |
ttaacaacaacacgtttaacactcttgacaaaagctcgtgttggatccatggagcttccgtccaaagtgaatnnnnnnnnnnnnnngttagtgtaagttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23220145 |
ttaacaacaacacgtttaacactcttgacaaaagctcgtgttggatccatggagcttccgtccaaagtgaatcacacacacacacagttagtgtaagttg |
23220244 |
T |
|
| Q |
217 |
acacgttacgttatt |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
23220245 |
acacgttacgttatt |
23220259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University