View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13303_low_20 (Length: 214)
Name: NF13303_low_20
Description: NF13303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13303_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 27098717 - 27098904
Alignment:
| Q |
18 |
aaatgaagtaattgaaattcttcacacacactactgagtaagagaggaattagcattaccagtagaaggatcagaagaatttgagaaacaagaattctta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27098717 |
aaatgaagtaattgaaattcttcacacacactactgagtaagagaggaattagcattaccagtagaaggatcagaagaatttgagaaacaagaattctta |
27098816 |
T |
 |
| Q |
118 |
tgattatgcatccaaaccttaaaaacttgtctactcacaccaacactttcacaaaacctttcaatctcttcatcaagttcttctctct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27098817 |
tgattatgcatccaaaccttaaaaacttgtctactcacaccaacactttcacaaaacctttcaatctcttcatcaagttcttttctct |
27098904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University