View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13305_high_17 (Length: 212)
Name: NF13305_high_17
Description: NF13305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13305_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 53558046 - 53557869
Alignment:
| Q |
18 |
catagggttgttattagagttttgaaggctaatttggatcattttttcttgagaaggatgcaactttggccaaactagtgcagcagggttattactgtaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53558046 |
catagggttgttattagagttttgaaggctaatttggatcattttttcttgagaaggatgcaactttggccaaactagtgcagcagggttattattgtaa |
53557947 |
T |
 |
| Q |
118 |
aaagacaaagggttttgaaggctttgaagttgcatatgaagttgaagtctctcaagagctgagctacttaatgaattt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53557946 |
aaagacaaagggttttgaaggctttgaagttgcatatgaagttgaagtctctcaagagctgagctacttaatgaattt |
53557869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University