View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13305_high_8 (Length: 446)
Name: NF13305_high_8
Description: NF13305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13305_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 18 - 431
Target Start/End: Complemental strand, 29124056 - 29123640
Alignment:
| Q |
18 |
agatagagagagagaaacaccattcttttccatttttcaataaccctttttcaatttgctttctttgcacactcacactgtgaaaaacatcaactttgtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29124056 |
agatagagagagagaaacaccattcttttccatttttcaataaccctttttcaatttgctttctttgcacactcacactgtgaaaaacatcaactttttt |
29123957 |
T |
 |
| Q |
118 |
-gannnnnnnnn-cttcgcaattcctagcttcaatttgttcacaggtggaattggtgttgttgcaacataccctttggatattattgcttacaaatgtat |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29123956 |
tgattttttttttcttcgcaattcctagcttcaatttgttcacaggtggaattggtgttgttgcaacataccctttggatattattgcttacaaatgtat |
29123857 |
T |
 |
| Q |
216 |
gtatgatttcttatcccttctcattggttatgcttttatatgcatgttgctttttgttttgtgtttcatgtatttggggtgttgaattttgctgtaactc |
315 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29123856 |
gtatgatttcttatcccttctcattgtttattcttttatatgcatgttgctttttgttttgtgtttcatgtatttggggtgttgaattttgctgtaactc |
29123757 |
T |
 |
| Q |
316 |
aaaacccattttgccaaaggttctgactctatttcagaaacatcatg-ttttatgtttttagcttttgtatgtcattttgaggttctgagattgtactgt |
414 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29123756 |
aaaacccattttgccaaaggttgtgactttatttcagaaacatcatgcttttatgtttttagcttttgtatgtcattttgaggttctgagattgtactgt |
29123657 |
T |
 |
| Q |
415 |
ggtattttgtggtctat |
431 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29123656 |
ggtattttgtggtctat |
29123640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University