View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13305_low_8 (Length: 468)
Name: NF13305_low_8
Description: NF13305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13305_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 34675325 - 34675014
Alignment:
| Q |
1 |
cgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggtgcaaagatgcagcctggcatgcattttcgacgaaggaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675325 |
cgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggtgcaaagatgcagcctggcatgcattttcgacgaaggaattt |
34675226 |
T |
 |
| Q |
101 |
gcaggctgcacatggtgaattgtatgagcttgatgatgccattttttctcctgcgctacaaagcaat-nnnnnnntattgagtcatacaaaatatgaatc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34675225 |
gcaggctgcacatggtgaattgtatgagcttgatgatgccattttttctcctgcgctacaaagcaataaaaaaaatattgagtcatacaaaatatgaatc |
34675126 |
T |
 |
| Q |
200 |
tatttatcttctaactttcccttc--tacatcgtgttttcaagtaataatcagttttagtttcaaaagttattacaaaactcaatggtcacaaata---a |
294 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34675125 |
tatttatcttctaactttcccttctatacatcgtgttttcaagtaataatcag-tttagtttcaaaagttattacaaaactcaatggtcacaaataaaga |
34675027 |
T |
 |
| Q |
295 |
atatcagatctaa |
307 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34675026 |
atatcagatctaa |
34675014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 12 - 146
Target Start/End: Complemental strand, 43583303 - 43583166
Alignment:
| Q |
12 |
ttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggtgcaaagatgcagcctggcatgcattttcgacgaaggaatttgcaggctgcac |
111 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| || || ||||| |||||||||||||| |||||||||||||||| | | |||||||||||| |||| |
|
|
| T |
43583303 |
ttgtgcacgtttgcaaatttttgaggctcttctggagggaagtaaggtgcaaagatgcatcctggcatgcattttctcctcaagaatttgcaggcagcac |
43583204 |
T |
 |
| Q |
112 |
atggtgaattgtatgagct---tgatgatgccattttt |
146 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
43583203 |
aaggtgaattgtatgagctggatgatgatgccattttt |
43583166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 12 - 82
Target Start/End: Original strand, 12360791 - 12360861
Alignment:
| Q |
12 |
ttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggtgcaaagatgcagcctggcatgca |
82 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| ||||| || ||||| ||||| ||||| |||||||||| |
|
|
| T |
12360791 |
ttgtgaacatttgcaaatttttgtggttcttctggtgggaaatatggagcaaatatgcaatctggcatgca |
12360861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University