View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13306_high_3 (Length: 458)
Name: NF13306_high_3
Description: NF13306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13306_high_3 |
 | |
|
| [»] scaffold0204 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0204 (Bit Score: 245; Significance: 1e-136; HSPs: 3)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 17 - 322
Target Start/End: Original strand, 18018 - 18307
Alignment:
| Q |
17 |
gtatagtaatgttcatccttgataaagtattattttctcttacatgcagctttctgtaatataaaagaaatggaagatgggtcttcccctacgggtggtg |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18018 |
gtatagtaatgttcatccttcataaagtattattttctcttacatgcagctttctgtaatataaaagaaatggaagatgggtcttcccctacgggtggtg |
18117 |
T |
|
| Q |
117 |
gtactgtagataagggaagagctgagcaatataaaggaagggtcactgttcatgttatcattgcttgcattgttgctgctactggtgggtccctttttgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18118 |
gtactgtagataagggaagagctgagcaatataaaggaagggtcactgttcatgttatcattgcttgcattgttgctgctactggtgggtccctttttgg |
18217 |
T |
|
| Q |
217 |
ctatgatgttggtatttcaggttctgtcttaatcccttcactctcaaaacttcttcatattgattttatattaaccttcactttcaggttattattctgg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18218 |
ctatgatgttggtatttcaggttctgtcttaatcccttcactctca----------------attttatattcaccttcactttcaggttattattctgg |
18301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 348 - 443
Target Start/End: Original strand, 18321 - 18415
Alignment:
| Q |
348 |
gttaaaaaacttcaacttacttgtgttgtttgtgtttgaaagctgaaaagggaaatacacatgggttgaatctcattttcttgattgttctttcat |
443 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18321 |
gttaaaaaacttcaact-acttgtgttgtttgtgtttgaaagctgaaaagggaaatacacatgggttgaatctcattttcttgagtgttctttcat |
18415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 158 - 242
Target Start/End: Original strand, 5347 - 5431
Alignment:
| Q |
158 |
gtcactgttcatgttatcattgcttgcattgttgctgctactggtgggtccctttttggctatgatgttggtatttcaggttctg |
242 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||||||||| ||||| ||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
5347 |
gtcacagttcatgtcatccttgcttgcattgttgctgccactggagggtctctatttggctatgatgttggtatttcaggttctg |
5431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 17 - 322
Target Start/End: Original strand, 48330496 - 48330785
Alignment:
| Q |
17 |
gtatagtaatgttcatccttgataaagtattattttctcttacatgcagctttctgtaatataaaagaaatggaagatgggtcttcccctacgggtggtg |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48330496 |
gtatagtaatgttcatccttcataaagtattattttctcttacatgcagctttctgtaatataaaagaaatggaagatgggtcttcccctacgggtggtg |
48330595 |
T |
|
| Q |
117 |
gtactgtagataagggaagagctgagcaatataaaggaagggtcactgttcatgttatcattgcttgcattgttgctgctactggtgggtccctttttgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48330596 |
gtactgtagataagggaagagctgagcaatataaaggaagggtcactgttcatgttatcattgcttgcattgttgctgctactggtgggtccctttttgg |
48330695 |
T |
|
| Q |
217 |
ctatgatgttggtatttcaggttctgtcttaatcccttcactctcaaaacttcttcatattgattttatattaaccttcactttcaggttattattctgg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48330696 |
ctatgatgttggtatttcaggttctgtcttaatcccttcactctca----------------attttatattcaccttcactttcaggttattattctgg |
48330779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 110 - 269
Target Start/End: Original strand, 48342455 - 48342616
Alignment:
| Q |
110 |
ggtggtggtactgtagataag---ggaagagctgagcaatataaaggaagggtcactgttcatgttatcattgcttgcattgttgctgctactggtgggt |
206 |
Q |
| |
|
|||||||||||||| |||||| ||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48342455 |
ggtggtggtactgtggataagaacggaagggcagagcaatataagggaagggtcactgttcatgttatcattgcttgcattgttgctgctactggtgggt |
48342554 |
T |
|
| Q |
207 |
ccctttttggctatgatgttggtatttcaggttctgtcttaatcccttcactctcaaaacttc |
269 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48342555 |
ccctttttggctatgacgttggtatttcaggtt-tgtcttaatcccttcactctcaaaacttc |
48342616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 348 - 443
Target Start/End: Original strand, 48330799 - 48330893
Alignment:
| Q |
348 |
gttaaaaaacttcaacttacttgtgttgtttgtgtttgaaagctgaaaagggaaatacacatgggttgaatctcattttcttgattgttctttcat |
443 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48330799 |
gttaaaaaacttcaact-acttgtgttgtttgtgtttgaaagctgaaaagggaaatacacatgggttgaatctcattttcttgagtgttctttcat |
48330893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 418
Target Start/End: Original strand, 48342721 - 48342757
Alignment:
| Q |
382 |
tttgaaagctgaaaagggaaatacacatgggttgaat |
418 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
48342721 |
tttgaaagctgaaaagggaaatacatatgagttgaat |
48342757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 146 - 240
Target Start/End: Complemental strand, 41416562 - 41416468
Alignment:
| Q |
146 |
tataaaggaagggtcactgttcatgttatcattgcttgcattgttgctgctactggtgggtccctttttggctatgatgttggtatttcaggttc |
240 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| ||||||||||||||||| || || || |||||||||||||||||||| ||||||||||| |
|
|
| T |
41416562 |
tataaagggagggtcactccctatgttatcattgcatgcattgttgctgctacaggaggatcactttttggctatgatgttggaatttcaggttc |
41416468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 168 - 241
Target Start/End: Complemental strand, 36296889 - 36296816
Alignment:
| Q |
168 |
atgttatcattgcttgcattgttgctgctactggtgggtccctttttggctatgatgttggtatttcaggttct |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||| || || || |||||||||||||||||||| |||||||||||| |
|
|
| T |
36296889 |
atgttatcattgcttgcattgttgcagctacagggggatcactttttggctatgatgttggaatttcaggttct |
36296816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University