View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13306_low_22 (Length: 311)
Name: NF13306_low_22
Description: NF13306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13306_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 34087638 - 34087426
Alignment:
| Q |
17 |
acttttgatgtcggg-ttaccttttcacaataaaaattaagaaaacttaactcttgctggtatttgatttaagttgacagtttggattttaatgcattta |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34087638 |
acttttgatgtcggggttaccttttcacaataaaaattaagaaaacttaactcttgctggtatttgatttaagttgacagtttggattttaatgcattta |
34087539 |
T |
|
| Q |
116 |
aactgtatttgtttcttcatgagcgagcatagtatgaatccacgattcaacacaaaataatccactgtcgttcatttgagttgtgtttttcaaatcataa |
215 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34087538 |
aactgtatttatttcttcacgagcgagcatattatgaatccacgattcaacac--aataatccactgtcgttcatttgagttgtgtttttcaaatcataa |
34087441 |
T |
|
| Q |
216 |
atgttaatatgttaa |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34087440 |
atgttaatatgttaa |
34087426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 232 - 294
Target Start/End: Complemental strand, 34087398 - 34087336
Alignment:
| Q |
232 |
ttttctagttagaacttaaactttggatttttaactcctcaattcatttaaactataattcat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34087398 |
ttttctagttagaacttaaactttggatttttaactcctcaattcatttaaactataattcat |
34087336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University