View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13306_low_25 (Length: 281)
Name: NF13306_low_25
Description: NF13306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13306_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 271
Target Start/End: Original strand, 35094318 - 35094570
Alignment:
| Q |
19 |
ctattaacattgttcatttgtttgtatcttttgacgacaacagtagggccagtcaacaaagcagccttataggatgaactgtgacaaccacttcctaata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35094318 |
ctattaacattgttcatttgtttgtatcttttgacgacaacagtagggccagtcaacaaagcagccttataggatgaactgtgacaaccacttcctaata |
35094417 |
T |
 |
| Q |
119 |
tctcagcagcggctctcaaaagatcttgcaaatcaaattgtgctgatacttcttccctcacaaaggacaacttgctatctccttttctgctactggtatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35094418 |
tctcagcagcggctctcaaaagatcttgcaaatcaaattgtgctgatacttcttccctcacaaaggacaacttgctatctccttttctgctactggtatt |
35094517 |
T |
 |
| Q |
219 |
actgcttgcgcgtgatcttaccgaaccctcgtctgtattattatttgatgatg |
271 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35094518 |
actgcttgtgcgtgatcttaccgaaccctcgtctgtattattatttgatgatg |
35094570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University