View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13307_low_14 (Length: 287)
Name: NF13307_low_14
Description: NF13307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13307_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 8e-61; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 31161786 - 31161652
Alignment:
| Q |
1 |
tctgttcaaactatatacaacgaataataattcaagtaaatttttacttccattgaattaaaacaaacgcattgtctctatgggcttaactcagttggta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31161786 |
tctgttcaaactatatacaacgaataataattcaagtaaatttttacttccattgaattaaaacaaacgcattgtctctgtgggcttaactcagttggta |
31161687 |
T |
 |
| Q |
101 |
aggacaatgtgtacgaggttcgaaccccgaatacc |
135 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||||||| |
|
|
| T |
31161686 |
aggacaatgcgtacgagattcgaactccgaatacc |
31161652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 177 - 276
Target Start/End: Complemental strand, 31161614 - 31161515
Alignment:
| Q |
177 |
tttatatttatacctcattggatgcaatatcatccattatcctgccaataacaatagcagcattaacaatttttgtttcatttgatacccacttgatgat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31161614 |
tttatatttatacctcattggatgcaatgtcatccattatcctgccaataacaatagcagcattaacaatttttgtttcatttgatacccacttgatgat |
31161515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 179 - 272
Target Start/End: Original strand, 41349656 - 41349749
Alignment:
| Q |
179 |
tatatttatacctcattggatgcaatatcatccattatcctgccaataacaatagcagcattaacaatttttgtttcatttgatacccacttga |
272 |
Q |
| |
|
||||| |||||||| |||||| ||||||||||||||||||||| || |||||||||||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
41349656 |
tatatatatacctcgttggatacaatatcatccattatcctgcaaaggacaatagcagcattaataatttttgactcatttgatacccatttga |
41349749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 177 - 280
Target Start/End: Complemental strand, 31201418 - 31201315
Alignment:
| Q |
177 |
tttatatttatacctcattggatgcaatatcatccattatcctgccaataacaatagcagcattaacaatttttgtttcatttgatacccacttgatgat |
276 |
Q |
| |
|
||||||| | |||||||||||| |||| |||||||||| ||| ||||| | ||| |||||||||| || ||||| ||||||||||||||||||| ||| |
|
|
| T |
31201418 |
tttatatatgtacctcattggacacaatgtcatccattaaccttccaatgataattgcagcattaataacttttggatcatttgatacccacttgaagat |
31201319 |
T |
 |
| Q |
277 |
gtcc |
280 |
Q |
| |
|
|||| |
|
|
| T |
31201318 |
gtcc |
31201315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 177 - 272
Target Start/End: Original strand, 4314819 - 4314914
Alignment:
| Q |
177 |
tttatatttatacctcattggatgcaatatcatccattatcctgccaataacaatagcagcattaacaatttttgtttcatttgatacccacttga |
272 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||||||| ||||| || | |||||||||||| | |||||| || |||||||||||||||||| |
|
|
| T |
4314819 |
tttatcttcatacctcgttggatgcaatatcatccattagcctgcaaaggataatagcagcattgatcatttttattccatttgatacccacttga |
4314914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 178 - 279
Target Start/End: Complemental strand, 25794101 - 25794000
Alignment:
| Q |
178 |
ttatatttatacctcattggatgcaatatcatccattatcctgccaataacaatagcagcattaacaatttttgtttcatttgatacccacttgatgatg |
277 |
Q |
| |
|
|||||| |||||||||||||| |||| |||||||||| ||||| || |||| || |||||||| |||||||| |||||||||| |||||||| |||| |
|
|
| T |
25794101 |
ttatatatatacctcattggacacaatgtcatccattagcctgcaaagtacaacagaagcattaagaatttttggctcatttgatatccacttgaagatg |
25794002 |
T |
 |
| Q |
278 |
tc |
279 |
Q |
| |
|
|| |
|
|
| T |
25794001 |
tc |
25794000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 73 - 110
Target Start/End: Complemental strand, 28757092 - 28757055
Alignment:
| Q |
73 |
tgtctctatgggcttaactcagttggtaaggacaatgt |
110 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
28757092 |
tgtctctgtgagcttaactcagttggtaaggacaatgt |
28757055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University