View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13307_low_15 (Length: 283)
Name: NF13307_low_15
Description: NF13307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13307_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 50 - 273
Target Start/End: Original strand, 8683056 - 8683279
Alignment:
| Q |
50 |
gataattagggttttgaatgtaatttcaggtggtagctgcaggttcgaagttcagtttaagaagaggaaacagtggttcatgttcttctaataatgttgt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683056 |
gataattagggttttgaatgtaatttcaggtggtagctgcaggttcgaagttcagtttaagaagaggaaacagtggttcatgttcttctaataatgttgt |
8683155 |
T |
 |
| Q |
150 |
tatcaatgaagaactttctagaattaataacaaaagtgcttgtttttctcaagacccttcttgtgtttcattcactacttttaatatccttgctcctatt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683156 |
tatcaatgaagaactttctagaattaataacaaaagtgcttgtttttctcaagacccttcttgtgtttcattcactacttttaatatccttgctcctatt |
8683255 |
T |
 |
| Q |
250 |
tacaaaaggattgatccacaggtt |
273 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8683256 |
tacaaaaggattgatccacaggtt |
8683279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University