View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13307_low_18 (Length: 245)
Name: NF13307_low_18
Description: NF13307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13307_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 43 - 238
Target Start/End: Complemental strand, 8671567 - 8671372
Alignment:
| Q |
43 |
gacattattcttgggattgtatatcgatccactcaagatcnnnnnnnnctatgtccttccactcaagatcttttttctatagtcaatccaacaaaaatct |
142 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8671567 |
gacattattcttgagattgtatatcgatccactcaagatcttttttttctatgtccttccactcaagatcttttttctatagtcaatccaacaaaaatct |
8671468 |
T |
|
| Q |
143 |
atgcatatcttctttcgatcgaaactggctcgtgcgttctggtccctttttgggctacacctacaatagaaaggatttgggtcccctccttctgtg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8671467 |
atgcatatcttctttcgatcgaaactggctcgtgcgttctggtccctttttgggctacacctacaatagaaaggatttgggtcccctccttctgtg |
8671372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 44 - 238
Target Start/End: Complemental strand, 8714372 - 8714179
Alignment:
| Q |
44 |
acattattcttgggattgtatatcgatccactcaagatcnnnnnnnn--ctatgtccttccactcaagatcttttttctatagtcaatccaacaaaaatc |
141 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||| || |||||||||||||||||||||||||||||| |||| || |
|
|
| T |
8714372 |
acattattcttgggattgtatatcaatccactcaagatatttttttttcctatgtcgatctactcaagatcttttttctatagtcaatccaccaaagatg |
8714273 |
T |
|
| Q |
142 |
tatgcat-atcttctttcgatcgaaactggctcgtgcgttctggtccctttttgggctacacctacaatagaaaggatttgggtcccctccttctgtg |
238 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||| |||| |
|
|
| T |
8714272 |
tatgcattatcttctttcga----aaatggctcgtgcgttctggtcccgttttgggctacacctacaatagagaggatttggatcccctccttatgtg |
8714179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University