View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13307_low_22 (Length: 227)
Name: NF13307_low_22
Description: NF13307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13307_low_22 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 3163539 - 3163319
Alignment:
| Q |
7 |
tttgtcatatatttgaaattcaaacttagattagtacgaagatgcttaaaacttactatcaattgaggtgaaaacacacgctgaagtgtgagatcgaact |
106 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
3163539 |
tttgtcatatatgtgaaattcaaacttagataagtatgaagatgcttaaaacttactatcaattgaggtgaaaacacacattgaggtgtgagatcgaact |
3163440 |
T |
 |
| Q |
107 |
ctaaaaaccctcgattaaaatgagttttaagaatctttgtaattgtcccttagtatgtggcaaaaactcagaaaatgatcgtcaagacaacaatatttcg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3163439 |
ctaaaaaccctcgattaaaatgagttttaagaatctttgtacttgtcccttagtacgtggcaaaaactcagaaaatgatcgtcaagacaacaatatttcg |
3163340 |
T |
 |
| Q |
207 |
gatcttatagaaaaagtaaaa |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3163339 |
gatcttatagaaaaagtaaaa |
3163319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University