View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13308_high_1 (Length: 321)
Name: NF13308_high_1
Description: NF13308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13308_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 191 - 302
Target Start/End: Original strand, 37004341 - 37004452
Alignment:
| Q |
191 |
gtgatggccacaaacaagcaaaatatcccattgttggcttgcatttagccagcctagattatagtggtgtgtttgtcccgtattatttgaaatctctcga |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37004341 |
gtgatggccacaaacaagcaaaatatcccattgttggcttgcatttagcctgcctagattatagtggtgtgtttgtcccgtattatttgaaatctctcga |
37004440 |
T |
 |
| Q |
291 |
ctttggtatatt |
302 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37004441 |
ctttggtatatt |
37004452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 37004151 - 37004276
Alignment:
| Q |
1 |
tacactagacgccgctataaacaagggcatatcattatttattgtacnnnnnnnggtctagcattatttatcatgttgagttttattttgtgttacgtta |
100 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37004151 |
tacaccagacgccgctataaacaaggacatatcattatttattgtactttttttggtctagcattatttatcatgttgagttttattttgtgttacgtta |
37004250 |
T |
 |
| Q |
101 |
ataataattattgagtttaatattat |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37004251 |
ataataattattgagtttaatattat |
37004276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University