View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13308_low_5 (Length: 266)
Name: NF13308_low_5
Description: NF13308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13308_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 256
Target Start/End: Complemental strand, 45693610 - 45693374
Alignment:
| Q |
20 |
ttgctgacttgatatttcttaggcggataaagcttcaatgctagatgaggcaattgagtatcttaaatcacttcaactccaactgcaagtattctttctc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45693610 |
ttgctgacttgatatttcttaggcggataaagcttcaatgctggatgaggcaattgagtatcttaaatcacttcaactccaactgcaagtattctttctc |
45693511 |
T |
|
| Q |
120 |
ttcccttttacattttcccttcaatcctttgaattttgatatttcacattatattatatccattctaacgcgatattttttctgatctttttacacagat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45693510 |
ttcccttttacattttcccttcaatcctttgaattttgatatttcacattatattatatccattctaatgcgatattttttctgatctttttacacagat |
45693411 |
T |
|
| Q |
220 |
catgtcaatgggaggtggtggtttatacatgcctatg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45693410 |
catgtcaatgggaggtggtggtttatacatgcctatg |
45693374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 39 - 110
Target Start/End: Original strand, 37935686 - 37935757
Alignment:
| Q |
39 |
taggcggataaagcttcaatgctagatgaggcaattgagtatcttaaatcacttcaactccaactgcaagta |
110 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||||||||||||||| ||| ||||||| |||||| | |||||| |
|
|
| T |
37935686 |
taggtggataaagcttctatgctggatgaggcaattgagtatctaaaaacacttcagctccaagttcaagta |
37935757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University