View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13310_high_20 (Length: 239)
Name: NF13310_high_20
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13310_high_20 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 27842542 - 27842768
Alignment:
| Q |
16 |
atatgtatttgacaaatgtctcgaatattttt--gtatatcttt-ttctatatctgatccaaaccaacccattggttatcgatttggtcctgcttgagct |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||| || ||| |||||||||||||||||||||||||||||||||||| ||||||||| ||||| | |
|
|
| T |
27842542 |
atatgtatttcacaaatgtctcgaatatttttttgtacatttttattctatatctgatccaaaccaacccattggttatcggtttggtcctctttgagat |
27842641 |
T |
 |
| Q |
113 |
ttaacccaaaaatgtttaaatccaactcaaatcactttgtatacttttgatcagtttgagcaatgggttcactcaacaacgaatcaatcagccccacgaa |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| | |||||||||| |
|
|
| T |
27842642 |
ttaacccaaaaatgtgtaaatccaactcaaatcactttgtatactttttatcagtttgagcaatgggttcactcaaaaacgaatcagacggccccacgaa |
27842741 |
T |
 |
| Q |
213 |
cacatatattgaacatgcttttcagat |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27842742 |
cacatatattgaacatgcttttcagat |
27842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 203 - 239
Target Start/End: Original strand, 27842834 - 27842870
Alignment:
| Q |
203 |
gccccacgaacacatatattgaacatgcttttcagat |
239 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27842834 |
gcccgacgaacacatatattgaacatgcttttcagat |
27842870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University