View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13310_high_22 (Length: 233)
Name: NF13310_high_22
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13310_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 2064278 - 2064470
Alignment:
| Q |
19 |
gatgaaatcgaagccgatagtctgtccacgtaatccttcaaccaatgtccacttccagcaacttcaccagcgatagtattttcatgtgtcatagatgaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064278 |
gatgaaatcgaagccgatagtctgtccacgtaatccttcaaccaatgtccacttccagcaacttcaccagcgatagtattttcatgtgtcatagatgaat |
2064377 |
T |
 |
| Q |
119 |
cctccgataccggaatgtgaatgtctttctgatcggaaacacttctccggtgatcttgcgtaaacgaaacctccgaaggctcaactacataat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064378 |
cctccgataccggaatgtgaatgtctttctgatcggaaacacttctccggtgatcttgcgtaaacgaaacctccgaaggctcaactacataat |
2064470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University