View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13310_high_22 (Length: 233)

Name: NF13310_high_22
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13310_high_22
NF13310_high_22
[»] chr8 (1 HSPs)
chr8 (19-211)||(2064278-2064470)


Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 2064278 - 2064470
Alignment:
19 gatgaaatcgaagccgatagtctgtccacgtaatccttcaaccaatgtccacttccagcaacttcaccagcgatagtattttcatgtgtcatagatgaat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2064278 gatgaaatcgaagccgatagtctgtccacgtaatccttcaaccaatgtccacttccagcaacttcaccagcgatagtattttcatgtgtcatagatgaat 2064377  T
119 cctccgataccggaatgtgaatgtctttctgatcggaaacacttctccggtgatcttgcgtaaacgaaacctccgaaggctcaactacataat 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2064378 cctccgataccggaatgtgaatgtctttctgatcggaaacacttctccggtgatcttgcgtaaacgaaacctccgaaggctcaactacataat 2064470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University