View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13310_high_25 (Length: 210)

Name: NF13310_high_25
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13310_high_25
NF13310_high_25
[»] chr8 (1 HSPs)
chr8 (21-124)||(32125449-32125552)


Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 21 - 124
Target Start/End: Complemental strand, 32125552 - 32125449
Alignment:
21 ggatatgtcgatcagtgcacaccgatcctgttgctgtgcttgcccctttctttgtcttgatttcgaagcgttcttttccgagtcttcgatcttccctgaa 120  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32125552 ggatatgtcgatcagtgcacaccgatcctgttgttgtgcttgcccctttctttgtcttgatttcgaagcgttcttttccgagtcttcgatcttccctgaa 32125453  T
121 ccaa 124  Q
    ||||    
32125452 ccaa 32125449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University