View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13310_high_25 (Length: 210)
Name: NF13310_high_25
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13310_high_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 21 - 124
Target Start/End: Complemental strand, 32125552 - 32125449
Alignment:
| Q |
21 |
ggatatgtcgatcagtgcacaccgatcctgttgctgtgcttgcccctttctttgtcttgatttcgaagcgttcttttccgagtcttcgatcttccctgaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32125552 |
ggatatgtcgatcagtgcacaccgatcctgttgttgtgcttgcccctttctttgtcttgatttcgaagcgttcttttccgagtcttcgatcttccctgaa |
32125453 |
T |
|
| Q |
121 |
ccaa |
124 |
Q |
| |
|
|||| |
|
|
| T |
32125452 |
ccaa |
32125449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University