View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13310_high_26 (Length: 203)
Name: NF13310_high_26
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13310_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 47910692 - 47910865
Alignment:
| Q |
17 |
cagttttctggaggtggcgtgtctgttctgagtgttgggggatcagctatggttgtctttgccttgttgtcccctgttttccctatctggtctgggttgt |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47910692 |
cagttttttggaggtggcgtgtctgttctgagtgttgggggatcagctatggttgtctttgccttgttgtcccctgttttccctatctggtatgggttgt |
47910791 |
T |
 |
| Q |
117 |
agggttcagttgcagctgtgcttgccttgatactatggtgttttgcgcatctcgttttgttgggttgtgtttga |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47910792 |
agggttcagttgcagctgtgcttgccttgatactatggtgttttgcgaatctcgttttgttgggttgtgtttga |
47910865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 7186481 - 7186654
Alignment:
| Q |
17 |
cagttttctggaggtggcgtgtctgttctgagtgttgggggatcagctatggttgtctttgccttgttgtcccctgttttccctatctggtctgggttgt |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7186481 |
cagttttttggaggtggcgtgtctgttctgagtgttgggggatcagctatggttgtctttgccttgttgtcccctgttttccctatctggtatgggttgt |
7186580 |
T |
 |
| Q |
117 |
agggttcagttgcagctgtgcttgccttgatactatggtgttttgcgcatctcgttttgttgggttgtgtttga |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7186581 |
agggttcagttgcagctgtgcttgccttgatactatggtgttttgcgtatctcgttttgttgggttgtgtttga |
7186654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University