View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13310_high_8 (Length: 431)
Name: NF13310_high_8
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13310_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 1 - 380
Target Start/End: Original strand, 29671641 - 29672020
Alignment:
| Q |
1 |
attgtagatacttggaccaaaagttttcccacgtcttccttctttcatttggatgttcttgattagtagattgatttggttgttcttgactagccatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671641 |
attgtagatacttggaccaaaagttttcccacgtcttccttctttcatttggatgttcttgattagtagattgatttggttgttcttgactagccatgct |
29671740 |
T |
|
| Q |
101 |
tggtgatgctgcatgttgttgcggcgtggaattcatatatacttgtcttaaaacaccggattcagttaacatttcttcaattttaaggcttataaaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671741 |
tggtgatgctgcatgttgttgcggcgtggaattcatatatacttgtcttaaaacaccggattcagttaacatttcttcaattttaaggcttataaaatct |
29671840 |
T |
|
| Q |
201 |
cttggccagggctctaacatctccaaagttgtgaaacctgacctgttcgtagcaattgctgctgttcttatttcaggctgcaaaagtaagtattctatgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671841 |
cttggccagggctctaacatctccaaagttgtgaaacctgacctgttcgtagcaattgctgctgttcttatttcaggctgcaaaagtaagtattctatgg |
29671940 |
T |
|
| Q |
301 |
tctgcaaacaaagtaacgaaaagcaaatcactagagagtgcagatcagagttgctataattattcttttaggtttcccaa |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671941 |
tctgcaaacaaagtaacgaaaagcaaatcactagagagtgcagatcagagttgctataattattcttttaggtttcccaa |
29672020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University