View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13310_low_19 (Length: 296)
Name: NF13310_low_19
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13310_low_19 |
 | |
|
| [»] scaffold0215 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0215 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: scaffold0215
Description:
Target: scaffold0215; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 122 - 277
Target Start/End: Original strand, 22500 - 22655
Alignment:
| Q |
122 |
ccttctttgcccaggtgaaccactcaatccgtgaagctttcgatttccaatcctcaaacatggaattcagttccttcgaaaatctccaaccatctttcac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22500 |
ccttctttgcccaggtgaaccactcaatccctgaagctttcgaattccaatcctcaaacatggaattcagttccttcgaaaatctccaaccatctttcac |
22599 |
T |
|
| Q |
222 |
ggttcccagaaccctgaaaatcccctttcttacttcttcgattctaccctcgaata |
277 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22600 |
ggttcccagaaccctgaaaataccctttcttacttcttcgattctaccctcgaata |
22655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 141; Significance: 6e-74; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 125 - 277
Target Start/End: Original strand, 16352684 - 16352836
Alignment:
| Q |
125 |
tctttgcccaggtgaaccactcaatccgtgaagctttcgatttccaatcctcaaacatggaattcagttccttcgaaaatctccaaccatctttcacggt |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16352684 |
tctttgcccaggtgaaccactcaatccctgaagctttcgaattccaatcctcaaacatggaattcagttccttcgaaaatctccaaccatctttcacggt |
16352783 |
T |
|
| Q |
225 |
tcccagaaccctgaaaatcccctttcttacttcttcgattctaccctcgaata |
277 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16352784 |
tcccagaaccctgaaaatcccctttcttccttcttcgattctaccctcgaata |
16352836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 122 - 277
Target Start/End: Complemental strand, 18851908 - 18851753
Alignment:
| Q |
122 |
ccttctttgcccaggtgaaccactcaatccgtgaagctttcgatttccaatcctcaaacatggaattcagttccttcgaaaatctccaaccatctttcac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
18851908 |
ccttctttgcccaggtgaaccactcaatccctgaagctttcgaattccaatcctcaaacatggaattcagttcttttgaaaatctccaaccatctttcac |
18851809 |
T |
|
| Q |
222 |
ggttcccagaaccctgaaaatcccctttcttacttcttcgattctaccctcgaata |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18851808 |
ggttcccagaaccctgaaaatcccctttcttacttcttcgattctaccctcgaata |
18851753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 18852011 - 18851958
Alignment:
| Q |
17 |
atgaaacaaaattttccccttctaattcaaataataacaaagaaacttcttgaa |
70 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
18852011 |
atgaaacaaaattttccccttccagttcaaataataacaaagaaacttcttgaa |
18851958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 16352628 - 16352671
Alignment:
| Q |
18 |
tgaaacaaaattttccccttctaattcaaataataacaaagaaa |
61 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
16352628 |
tgaaacaaaattttccccttccaattccaataataacaaagaaa |
16352671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University