View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13310_low_24 (Length: 256)
Name: NF13310_low_24
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13310_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 242
Target Start/End: Complemental strand, 8726609 - 8726383
Alignment:
| Q |
16 |
aaagatgcagtcagcttgcatgagtgcaaatccatgtgaattctggaaacttaatttgcctatcttataatggtgaaattcctaaaacaaacacatgcct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8726609 |
aaagatgcagtcagcttgcatgagtgcaaatccatgtgaattctgaaaacttaatttgcctatcttataatggtgaaattcctaaaacaaacacatgcct |
8726510 |
T |
|
| Q |
116 |
agtggcagcacctgcggatcgttaaacgtttctacggtccttatttgattatggaatggattggacaggttgcttacaaactggccttgcctcctgattc |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8726509 |
agtggcagcacctacggatcgttaaacgtttctacggtccttatttgattatggaacggattggacaggttgcttacaaactggccttgcctcctcattc |
8726410 |
T |
|
| Q |
216 |
caaaattcatgatgttctccattgctc |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8726409 |
caaaattcatgatgttctccattgctc |
8726383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University