View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13310_low_28 (Length: 236)
Name: NF13310_low_28
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13310_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 43887410 - 43887205
Alignment:
| Q |
15 |
agggacttagatctggcggtggtgctaccggcgttcatcaccaacggcaatactccgagaatttcctcgacagcgccaccactggaaaccgttggcttca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43887410 |
agggacttagatctggcggtggtgctaccggcgttcatcaccaacggcaatactccgagaatttcctcgacggcgccaccactggaaaccgttggcttca |
43887311 |
T |
 |
| Q |
115 |
atccgctggacttcaacatcttcaatcctccgctgcaaatcctcttcaggttcgtttcatcagttttctcattctcgatattcgagacgatcttgtgaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43887310 |
atccgctggacttcaacatcttcaatcctccgctgcaaatcctcttcaggttcgtttcatcagttttctcattctcgatattcgagacgatcttgtgaag |
43887211 |
T |
 |
| Q |
215 |
ttaatg |
220 |
Q |
| |
|
|||||| |
|
|
| T |
43887210 |
ttaatg |
43887205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University