View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13311_low_10 (Length: 222)
Name: NF13311_low_10
Description: NF13311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13311_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 14232607 - 14232443
Alignment:
| Q |
1 |
cgatacagtatttcatcaagcttgaaaccatgttgaagacgtgc-----atggctgagtgcagattttaaatttaataattgatcataaccgttcaatct |
95 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14232607 |
cgatacaatatttcatcaagcttgaaaccatgttgaagacgtgcggtgcatggctgagtgcagattttaaatttaataattgatcataaccgttcaatct |
14232508 |
T |
 |
| Q |
96 |
attcaacttcgagtgttgatgccctaggaaaaaggagtatgttgttttaagaaggccacgccatt |
160 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14232507 |
attcaacttcgattgttgatgccctagaaaaaaggagtatgccgttttaagaaggccacgccatt |
14232443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University